<!-- COPYRIGHT NOTICE This file is part of the "Universal Biomedical Skills" project. Copyright c 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu All Rights Reserved. This code is proprietary and confidential. Unauthorized copying of this file, via any medium is strictly prohibited. Provenance:
Install with the open skills CLI (global, non-interactive — available in every Claude Code session):
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill "bio-codon-usage" -g -a claude-code -yOr manually — clone and copy the skill directory (SKILL.md + companion files):
git clone --depth 1 https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills /tmp/OpenClaw-Medical-Skills && cp -r /tmp/OpenClaw-Medical-Skills/skills/bio-codon-usage ~/.claude/skills/bio-codon-usageThis skill is a directory: SKILL.md is the entry point; the files below ship with it.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-codon-usage
description: Analyze codon usage, calculate CAI (Codon Adaptation Index), and examine synonymous codon bias using Biopython. Use when analyzing coding sequences for expression optimization or evolutionary analysis.
tool_type: python
primary_tool: Bio.SeqUtils.CodonUsage
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Codon Usage
Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.
## Required Imports
```python
from Bio.Seq import Seq
from Bio.SeqUtils import GC123
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
from Bio.Data import CodonTable
from collections import Counter
```
## Basic Codon Counting
### Count Codons in Sequence
```python
from collections import Counter
def count_codons(seq):
seq_str = str(seq).upper()
codons = [seq_str[i:i+3] for i in range(0, len(seq_str) - 2, 3)]
return Counter(codons)
seq = Seq('ATGCGATCGATCGATCGTAA')
codon_counts = count_codons(seq)
```
### Codon Frequencies (Relative)
```python
def codon_frequencies(seq):
counts = count_codons(seq)
total = sum(counts.values())
return {codon: count / total for codon, count in counts.items()}
```
## Codon Adaptation Index (CAI)
### Using CodonUsage Module
```python
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
# Create CAI calculator with reference set
cai = CodonAdaptationIndex()
# Generate index from highly expressed genes
cai.generate_index('highly_expressed_genes.fasta')
# Calculate CAI for a sequence
seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}') # Range 0-1, higher = better adapted
```
### CAI with Custom Codon Index
```python
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
cai = CodonAdaptationIndex()
# Set custom index (relative adaptiveness for each codon)
custom_index = {
'TTT': 0.5, 'TTC': 1.0, # Phe
'TTA': 0.1, 'TTG': 0.5, 'CTT': 0.3, 'CTC': 1.0, 'CTA': 0.1, 'CTG': 1.0, # Leu
# ... define all 64 codons
}
cai.set_cai_index(custom_index)
```
## Synonymous Codon Usage
### RSCU (Relative Synonymous Codon Usage)
RSCU = (observed codon frequency) / (expected frequency if all synonymous codons were used equally)
```python
from Bio.Data import CodonTable
def calculate_rscu(seq, table_id=1):
codon_table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
# Group codons by amino acid
aa_to_codons = {}
for codon in counts:
if codon in codon_table.stop_codons:
continue
try:
aa = codon_table.forward_table[codon]
aa_to_codons.setdefault(aa, []).append(codon)
except KeyError:
continue
# Calculate RSCU for each codon
rscu = {}
for aa, codons in aa_to_codons.items():
total = sum(counts.get(c, 0) for c in codons)
n_synonymous = len(codons)
expected = total / n_synonymous if n_synonymous > 0 else 0
for codon in codons:
observed = counts.get(codon, 0)
rscu[codon] = observed / expected if expected > 0 else 0
return rscu
```
### Identify Rare Codons
```python
def find_rare_codons(seq, threshold=0.1):
freq = codon_frequencies(seq)
return {codon: f for codon, f in freq.items() if f < threshold}
```
### Codon Bias by Position (GC123)
```python
from Bio.SeqUtils import GC123
seq = Seq('ATGCGATCGATCGATCGATCGATCGATCGTAA')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)
print(f'Total GC: {gc_total:.1f}%')
print(f'1st position GC: {gc_pos1:.1f}%')
print(f'2nd position GC: {gc_pos2:.1f}%')
print(f'3rd position GC: {gc_pos3:.1f}% (wobble position)')
```
## Codon Tables
### Access Codon Tables
```python
from Bio.Data import CodonTable
# Get standard table
std_table = CodonTable.unambiguous_dna_by_id[1]
# List all available tables
for id, table in CodonTable.unambiguous_dna_by_id.items():
print(f'{id}: {table.names[0]}')
```
### Common Codon Tables
| ID | Name | Organism |
|----|------|----------|
| 1 | Standard | Most organisms |
| 2 | Vertebrate Mitochondrial | Human, mouse mito |
| 4 | Mold Mitochondrial | Fungi, protozoa mito |
| 5 | Invertebrate Mitochondrial | Insects, worms mito |
| 11 | Bacterial/Plastid | E. coli, chloroplasts |
### Codon Table Properties
```python
table = CodonTable.unambiguous_dna_by_id[1]
print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')
# Forward table: codon -> amino acid
print(table.forward_table['ATG']) # 'M'
# Back table: amino acid -> list of codons
back_table = {}
for codon, aa in table.forward_table.items():
back_table.setdefault(aa, []).append(codon)
print(f'Leucine codons: {back_table["L"]}')
```
## Code Patterns
### Full Codon Usage Report
```python
def codon_usage_report(seq, table_id=1):
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
total = sum(counts.values())
# Group by amino acid
aa_groups = {}
for codon, aa in table.forward_table.items():
aa_groups.setdefault(aa, []).append(codon)
report = {}
for aa, codons in sorted(aa_groups.items()):
aa_total = sum(counts.get(c, 0) for c in codons)
report[aa] = {
'total': aa_total,
'codons': {c: {'count': counts.get(c, 0),
'freq': counts.get(c, 0) / aa_total if aa_total > 0 else 0}
for c in codons}
}
return report
```
### Compare Codon Usage Between Sequences
```python
def compare_codon_usage(seq1, seq2):
freq1 = codon_frequencies(seq1)
freq2 = codon_frequencies(seq2)
all_codons = set(freq1.keys()) | set(freq2.keys())
comparison = {}
for codon in sorted(all_codons):
f1, f2 = freq1.get(codon, 0), freq2.get(codon, 0)
comparison[codon] = {'seq1': f1, 'seq2': f2, 'diff': f1 - f2}
return comparison
```
### Optimize Codons for Expression
```python
def optimize_codons(protein_seq, preferred_codons):
'''Replace codons with preferred synonymous codons'''
optimized = []
for aa in str(protein_seq):
if aa in preferred_codons:
optimized.append(preferred_codons[aa])
else:
optimized.append('NNN') # Unknown
return Seq(''.join(optimized))
# E. coli preferred codons
ecoli_preferred = {
'A': 'GCG', 'R': 'CGT', 'N': 'AAC', 'D': 'GAT', 'C': 'TGC',
'Q': 'CAG', 'E': 'GAA', 'G': 'GGT', 'H': 'CAC', 'I': 'ATT',
'L': 'CTG', 'K': 'AAA', 'M': 'ATG', 'F': 'TTC', 'P': 'CCG',
'S': 'TCT', 'T': 'ACC', 'W': 'TGG', 'Y': 'TAC', 'V': 'GTT',
}
```
### Codon Usage from FASTA File
```python
from Bio import SeqIO
def analyze_fasta_codon_usage(filename):
all_counts = Counter()
for record in SeqIO.parse(filename, 'fasta'):
all_counts.update(count_codons(record.seq))
total = sum(all_counts.values())
return {codon: count / total for codon, count in all_counts.items()}
```
### Effective Number of Codons (Nc)
A measure of codon bias (lower = more biased, range 20-61):
```python
import math
def effective_nc(seq, table_id=1):
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
# Group by degeneracy class
aa_groups = {}
for codon, aa in table.forward_table.items():
aa_groups.setdefault(aa, []).append(codon)
# Calculate F for each amino acid
nc_sum = 0
for aa, codons in aa_groups.items():
n = sum(counts.get(c, 0) for c in codons)
if n <= 1:
continue
pi_sq_sum = sum((counts.get(c, 0) / n) ** 2 for c in codons)
F = (n * pi_sq_sum - 1) / (n - 1)
nc_sum += 1 / F if F > 0 else len(codons)
return nc_sum if nc_sum > 0 else 61
```
## Property Reference
| Metric | Range | Interpretation |
|--------|-------|----------------|
| CAI | 0-1 | Higher = better adapted to host |
| RSCU | 0-N | 1.0 = no bias, >1 = overused, <1 = underused |
| Nc | 20-61 | Lower = more biased |
| GC3 | 0-100% | GC at wobble position |
## Common Errors
| Error | Cause | Solution |
|-------|-------|----------|
| `KeyError` | Non-standard codon | Handle N-containing codons |
| Wrong counts | Sequence not in frame | Ensure length is multiple of 3 |
| No index set | Called CAI without training | Call `generate_index()` first |
## Decision Tree
```
Need to analyze codon usage?
├── Count codon frequencies?
│ └── Use Counter on 3-mers
├── Calculate adaptation to host?
│ └── Use CodonAdaptationIndex (CAI)
├── Identify synonymous bias?
│ └── Calculate RSCU
├── Check wobble position bias?
│ └── Use GC123()
├── Measure overall bias?
│ └── Calculate Nc (effective number of codons)
└── Optimize for expression?
└── Replace with preferred synonymous codons
```
## Related Skills
- transcription-translation - Translate sequences and understand codon tables
- sequence-properties - GC123 for wobble position GC content
- sequence-io/read-sequences - Parse CDS sequences from GenBank files
- database-access/entrez-fetch - Fetch reference gene sets from NCBI for CAI training
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Search arXiv papers by keyword, author, category, or ID.
Gateway to 400+ bioinformatics skills from bioSkills and ClawBio. Covers genomics, transcriptomics, single-cell, variant calling, pharmacogenomics, metagenomics, structural biology, and more. Fetches domain-specific reference material on demand.
> Pharmaceutical research assistant for drug discovery workflows. Search bioactive compounds on ChEMBL, calculate drug-likeness (Lipinski Ro5, QED, TPSA, synthetic accessibility), look up drug-drug interactions via OpenFDA, interpret ADMET profiles, and assist with lead optimization. Use for medicinal chemistry questions, molecule property analysis, clinical pharmacology, and open-science drug research.