Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
Install with the open skills CLI (global, non-interactive — available in every Claude Code session):
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill "bio-read-qc-adapter-trimming" -g -a claude-code -yOr manually — clone and copy the skill directory (SKILL.md + companion files):
git clone --depth 1 https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills /tmp/OpenClaw-Medical-Skills && cp -r /tmp/OpenClaw-Medical-Skills/skills/bio-read-qc-adapter-trimming ~/.claude/skills/bio-read-qc-adapter-trimmingThis skill is a directory: SKILL.md is the entry point; the files below ship with it.
---
name: bio-read-qc-adapter-trimming
description: Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
tool_type: cli
primary_tool: cutadapt
---
## Version Compatibility
Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+
Before using code patterns, verify installed versions match. If versions differ:
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Adapter Trimming
Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).
**"Trim adapters from reads"** → Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment.
- CLI: `cutadapt -a ADAPTER -o out.fq in.fq` or `trimmomatic PE` with ILLUMINACLIP
- CLI: `fastp -i in.fq -o out.fq` (auto-detects adapters)
## Common Adapter Sequences
| Platform/Kit | Adapter | Sequence |
|--------------|---------|----------|
| Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| Nextera | Transposase | CTGTCTCTTATACACATCT |
| Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG |
| Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |
## Cutadapt
### Single-End Reads
```bash
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz
# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz
# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz
# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
```
### Paired-End Reads
```bash
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
```
### Adapter Options
```bash
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq
# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq
# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq
# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq
# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
```
### Linked Adapters
```bash
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq
# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
```
### Filtering After Trimming
```bash
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq
# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq
# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq
# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq
# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
```
### Paired-End Filtering
```bash
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
--too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
```
### Action Options
```bash
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq
# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq
# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
```
## Trimmomatic
### Single-End Mode
```bash
trimmomatic SE -phred33 \
input.fastq.gz output.fastq.gz \
ILLUMINACLIP:adapters.fa:2:30:10
```
### Paired-End Mode
```bash
trimmomatic PE -phred33 -threads 4 \
input_R1.fastq.gz input_R2.fastq.gz \
output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
```
### ILLUMINACLIP Parameters
```bash
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>
# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)
# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
```
### Built-in Adapter Files
Trimmomatic includes adapter files:
- `TruSeq2-SE.fa` - TruSeq v2 single-end
- `TruSeq2-PE.fa` - TruSeq v2 paired-end
- `TruSeq3-SE.fa` - TruSeq v3 single-end
- `TruSeq3-PE.fa` - TruSeq v3 paired-end
- `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode)
- `NexteraPE-PE.fa` - Nextera paired-end
### Find Trimmomatic Adapters
```bash
# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/
# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
```
## Performance
```bash
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq
# Trimmomatic threads
trimmomatic PE -threads 8 ...
```
## Verify Trimming
```bash
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz
# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
```
## Related Skills
- quality-reports - Check adapter content with FastQC
- quality-filtering - Quality trimming after adapter removal
- fastp-workflow - Combined adapter and quality trimming
Build fully-integrated 3-statement models (IS, BS, CF) in Excel with working capital schedules, D&A roll-forwards, debt schedule, and the plugs that make cash and retained earnings tie. Pairs with excel-author.
Airtable REST API via curl. Records CRUD, filters, upserts.
Search arXiv papers by keyword, author, category, or ID.