<!-- COPYRIGHT NOTICE This file is part of the "Universal Biomedical Skills" project. Copyright c 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu All Rights Reserved. This code is proprietary and confidential. Unauthorized copying of this file, via any medium is strictly prohibited. Provenance:
Install with the open skills CLI (global, non-interactive — available in every Claude Code session):
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill "bio-small-rna-seq-smrna-preprocessing" -g -a claude-code -yOr manually — clone and copy the skill directory (SKILL.md + companion files):
git clone --depth 1 https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills /tmp/OpenClaw-Medical-Skills && cp -r /tmp/OpenClaw-Medical-Skills/skills/bio-small-rna-seq-smrna-preprocessing ~/.claude/skills/bio-small-rna-seq-smrna-preprocessingThis skill is a directory: SKILL.md is the entry point; the files below ship with it.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-small-rna-seq-smrna-preprocessing
description: Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
tool_type: cli
primary_tool: cutadapt
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Small RNA Preprocessing
## Adapter Trimming with Cutadapt
Small RNA libraries have specific 3' adapters that must be removed:
```bash
# Standard Illumina TruSeq small RNA adapter
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-M 30 \
--discard-untrimmed \
-o trimmed.fastq.gz \
input.fastq.gz
# -a: 3' adapter sequence
# -m 18: Minimum length (miRNAs are 18-25 nt)
# -M 30: Maximum length (exclude longer fragments)
# --discard-untrimmed: Remove reads without adapter (likely not small RNA)
```
## Common Small RNA Adapters
| Kit | 3' Adapter Sequence |
|-----|---------------------|
| Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG |
| NEBNext | AGATCGGAAGAGCACACGTCT |
| QIAseq | AACTGTAGGCACCATCAAT |
| Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |
## Size Selection
```bash
# Filter by length after trimming
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 -M 26 \
-o mirna_length.fastq.gz \
input.fastq.gz
# miRNA: 18-26 nt (typically 21-23 nt)
# piRNA: 26-32 nt
# snoRNA: variable, typically longer
```
## Quality Trimming
```bash
# Trim low-quality bases from 3' end before adapter removal
cutadapt \
-q 20 \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-o trimmed.fastq.gz \
input.fastq.gz
```
## Using fastp for Small RNA
```bash
# fastp with small RNA settings
fastp \
--in1 input.fastq.gz \
--out1 trimmed.fastq.gz \
--adapter_sequence TGGAATTCTCGGGTGCCAAGG \
--length_required 18 \
--length_limit 30 \
--html report.html
# Note: fastp auto-detects adapters but specifying is more reliable
```
## Collapse Identical Reads
For small RNAs, collapsing identical sequences reduces computation:
```bash
# Using seqkit
seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta
# Using fastx_toolkit (legacy)
fastx_collapser -i trimmed.fastq -o collapsed.fasta
```
## Python Preprocessing
```python
import gzip
from collections import Counter
def collapse_reads(fastq_path):
'''Collapse identical sequences and count occurrences'''
counts = Counter()
with gzip.open(fastq_path, 'rt') as f:
while True:
header = f.readline()
if not header:
break
seq = f.readline().strip()
f.readline() # +
f.readline() # qual
# Only keep reads in miRNA size range
if 18 <= len(seq) <= 26:
counts[seq] += 1
return counts
# Write collapsed FASTA
def write_collapsed_fasta(counts, output_path):
with open(output_path, 'w') as f:
for i, (seq, count) in enumerate(counts.most_common()):
f.write(f'>seq_{i}_x{count}\n{seq}\n')
```
## QC Metrics for Small RNA
Key metrics to check:
- Read length distribution (should peak at 21-23 nt for miRNA)
- Adapter content (high if library is good)
- Percentage of reads in target size range
```python
import matplotlib.pyplot as plt
from collections import Counter
def plot_length_distribution(fastq_path):
lengths = Counter()
with gzip.open(fastq_path, 'rt') as f:
for i, line in enumerate(f):
if i % 4 == 1: # Sequence line
lengths[len(line.strip())] += 1
plt.bar(lengths.keys(), lengths.values())
plt.xlabel('Read Length')
plt.ylabel('Count')
plt.title('Small RNA Length Distribution')
plt.savefig('length_dist.png')
```
## Related Skills
- mirdeep2-analysis - Novel miRNA discovery
- mirge3-analysis - Fast miRNA quantification
- read-qc/adapter-trimming - General adapter trimming
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Build fully-integrated 3-statement models (IS, BS, CF) in Excel with working capital schedules, D&A roll-forwards, debt schedule, and the plugs that make cash and retained earnings tie. Pairs with excel-author.
Airtable REST API via curl. Records CRUD, filters, upserts.
Search arXiv papers by keyword, author, category, or ID.