<!-- COPYRIGHT NOTICE This file is part of the "Universal Biomedical Skills" project. Copyright c 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu All Rights Reserved. This code is proprietary and confidential. Unauthorized copying of this file, via any medium is strictly prohibited. Provenance:
Install with the open skills CLI (global, non-interactive — available in every Claude Code session):
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill "bio-transcription-translation" -g -a claude-code -yOr manually — clone and copy the skill directory (SKILL.md + companion files):
git clone --depth 1 https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills /tmp/OpenClaw-Medical-Skills && cp -r /tmp/OpenClaw-Medical-Skills/skills/bio-transcription-translation ~/.claude/skills/bio-transcription-translationThis skill is a directory: SKILL.md is the entry point; the files below ship with it.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-transcription-translation
description: Transcribe DNA to RNA and translate to protein using Biopython. Use when converting between DNA, RNA, and protein sequences, finding ORFs, or using alternative codon tables.
tool_type: python
primary_tool: Bio.Seq
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Transcription and Translation
Convert between DNA, RNA, and protein sequences using Biopython.
## Required Import
```python
from Bio.Seq import Seq
```
## Core Methods
### Transcription (DNA to RNA)
```python
dna = Seq('ATGCGATCGATCG')
rna = dna.transcribe() # Returns Seq('AUGCGAUCGAUCG')
```
Transcription replaces T with U. Works on coding strand (5' to 3').
### Back Transcription (RNA to DNA)
```python
rna = Seq('AUGCGAUCGAUCG')
dna = rna.back_transcribe() # Returns Seq('ATGCGATCGATCG')
```
### Translation (RNA/DNA to Protein)
```python
# From coding DNA (includes ATG start)
coding_dna = Seq('ATGTTTGGT')
protein = coding_dna.translate() # Returns Seq('MFG')
# From RNA
rna = Seq('AUGUUUGGU')
protein = rna.translate() # Returns Seq('MFG')
```
## Translation Options
### Stop at First Stop Codon
```python
seq = Seq('ATGTTTGGTTAAGGG')
protein = seq.translate(to_stop=True) # Stops at TAA, excludes stop
```
### Include Stop Codon Symbol
```python
seq = Seq('ATGTTTGGTTAA')
protein = seq.translate() # Returns Seq('MFG*')
```
### Alternative Codon Tables
Biopython supports NCBI codon tables. Common tables:
| ID | Name | Use Case |
|----|------|----------|
| 1 | Standard | Default, most organisms |
| 2 | Vertebrate Mitochondrial | Human/vertebrate mitochondria |
| 4 | Mold Mitochondrial | Fungi, protozoa mitochondria |
| 5 | Invertebrate Mitochondrial | Insects, worms mitochondria |
| 6 | Ciliate Nuclear | Tetrahymena, Paramecium |
| 11 | Bacterial/Archaeal | Prokaryotes, plastids |
```python
# Bacterial translation
seq = Seq('ATGTTTGGT')
protein = seq.translate(table=11)
# Mitochondrial translation
protein = seq.translate(table=2)
# By name
protein = seq.translate(table='Vertebrate Mitochondrial')
```
### CDS Translation (Complete Coding Sequence)
For validated coding sequences with proper start/stop:
```python
cds = Seq('ATGTTTGGTTAA') # Must start with start codon, end with stop
protein = cds.translate(cds=True) # Validates and removes stop
```
The `cds=True` option:
- Validates start codon (ATG or alternative)
- Validates stop codon at end
- Removes stop codon from result
- Raises error if invalid CDS
## Code Patterns
### Basic Transcription and Translation Pipeline
```python
dna = Seq('ATGTTTGGTCATTAA')
rna = dna.transcribe()
protein = rna.translate()
print(f'DNA: {dna}')
print(f'RNA: {rna}')
print(f'Protein: {protein}')
```
### Translate All Six Reading Frames
```python
def six_frame_translation(seq):
frames = []
for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
for frame in range(3):
length = 3 * ((len(s) - frame) // 3)
fragment = s[frame:frame + length]
frames.append((strand, frame, fragment.translate()))
return frames
seq = Seq('ATGCGATCGATCGATCGATCG')
for strand, frame, protein in six_frame_translation(seq):
print(f'{strand}{frame}: {protein}')
```
### Find All ORFs (Start to Stop)
```python
def find_orfs(seq, min_length=30):
orfs = []
for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
for frame in range(3):
trans = s[frame:].translate()
aa_start = 0
while True:
start = trans.find('M', aa_start)
if start == -1:
break
stop = trans.find('*', start)
if stop == -1:
stop = len(trans)
orf = trans[start:stop]
if len(orf) * 3 >= min_length:
orfs.append((strand, frame, start * 3 + frame, str(orf)))
aa_start = start + 1
return orfs
seq = Seq('ATGCGATCGATCGATCGATCGTAA')
for strand, frame, pos, orf in find_orfs(seq, min_length=3):
print(f'{strand} frame {frame} pos {pos}: {orf}')
```
### Translate with Quality Check
```python
def translate_cds_safe(seq):
try:
return seq.translate(cds=True)
except Exception as e:
return seq.translate(to_stop=True) # Fallback
```
### Get Codon Table Info
```python
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[1]
print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')
```
## Common Errors
| Error | Cause | Solution |
|-------|-------|----------|
| `TranslationError: First codon is not a start codon` | Used `cds=True` without valid start | Remove `cds=True` or fix sequence |
| `TranslationError: Final codon is not a stop codon` | Used `cds=True` without stop codon | Remove `cds=True` or add stop codon |
| `TranslationError: Sequence length not multiple of 3` | Partial codons at end | Trim sequence to multiple of 3 |
| Unexpected amino acids | Wrong codon table | Specify correct table for organism |
## Decision Tree
```
Need to convert sequence?
├── DNA to RNA?
│ └── Use seq.transcribe()
├── RNA to DNA?
│ └── Use seq.back_transcribe()
├── DNA/RNA to protein?
│ ├── Complete CDS with start/stop?
│ │ └── Use translate(cds=True)
│ ├── Stop at first stop codon?
│ │ └── Use translate(to_stop=True)
│ ├── Non-standard organism?
│ │ └── Use translate(table=N)
│ └── Get all including stop symbol?
│ └── Use translate()
└── Find all ORFs?
└── Translate all six frames, search for M...*
```
## Related Skills
- seq-objects - Create Seq objects for translation
- reverse-complement - Translate both strands (six-frame translation)
- codon-usage - Analyze codon bias in coding sequences
- sequence-io/read-sequences - Parse GenBank files with CDS features
- database-access/entrez-fetch - Fetch CDS sequences from NCBI for translation
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Search arXiv papers by keyword, author, category, or ID.
Gateway to 400+ bioinformatics skills from bioSkills and ClawBio. Covers genomics, transcriptomics, single-cell, variant calling, pharmacogenomics, metagenomics, structural biology, and more. Fetches domain-specific reference material on demand.
> Pharmaceutical research assistant for drug discovery workflows. Search bioactive compounds on ChEMBL, calculate drug-likeness (Lipinski Ro5, QED, TPSA, synthetic accessibility), look up drug-drug interactions via OpenFDA, interpret ADMET profiles, and assist with lead optimization. Use for medicinal chemistry questions, molecule property analysis, clinical pharmacology, and open-science drug research.