<!-- COPYRIGHT NOTICE This file is part of the "Universal Biomedical Skills" project. Copyright c 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu All Rights Reserved. This code is proprietary and confidential. Unauthorized copying of this file, via any medium is strictly prohibited. Provenance:
Install with the open skills CLI (global, non-interactive — available in every Claude Code session):
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill "bio-workflows-smrna-pipeline" -g -a claude-code -yOr manually — clone and copy the skill directory (SKILL.md + companion files):
git clone --depth 1 https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills /tmp/OpenClaw-Medical-Skills && cp -r /tmp/OpenClaw-Medical-Skills/skills/bio-workflows-smrna-pipeline ~/.claude/skills/bio-workflows-smrna-pipelineThis skill is a directory: SKILL.md is the entry point; the files below ship with it.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-workflows-smrna-pipeline
description: End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.
tool_type: mixed
primary_tool: miRDeep2
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Small RNA-seq Pipeline
## Pipeline Overview
```
FASTQ → cutadapt trim → miRDeep2 → Quantification → DESeq2 → Target prediction
```
## Step 1: Preprocessing
```bash
# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
--minimum-length 18 --maximum-length 30 \
-o trimmed.fastq.gz reads.fastq.gz
```
## Step 2: miRDeep2 Analysis
```bash
# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
-m -p genome_index -s reads_collapsed.fa \
-t reads_collapsed_vs_genome.arf
# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.fa
```
## Step 3: Differential Expression
```r
library(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)
```
## Step 4: Target Prediction
```bash
# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt
```
## QC Checkpoints
1. **After trimming**: Size distribution should peak at 21-23nt
2. **After alignment**: >70% mapping rate expected
3. **After DE**: Check volcano plot and PCA
## Related Skills
- small-rna-seq/mirdeep2-analysis - Detailed miRDeep2
- small-rna-seq/differential-mirna - DE analysis
- small-rna-seq/target-prediction - Target analysis
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Search arXiv papers by keyword, author, category, or ID.
Gateway to 400+ bioinformatics skills from bioSkills and ClawBio. Covers genomics, transcriptomics, single-cell, variant calling, pharmacogenomics, metagenomics, structural biology, and more. Fetches domain-specific reference material on demand.
> Pharmaceutical research assistant for drug discovery workflows. Search bioactive compounds on ChEMBL, calculate drug-likeness (Lipinski Ro5, QED, TPSA, synthetic accessibility), look up drug-drug interactions via OpenFDA, interpret ADMET profiles, and assist with lead optimization. Use for medicinal chemistry questions, molecule property analysis, clinical pharmacology, and open-science drug research.